Aerobic Exercise Attenuates Obesity-Associated Vascular Dysfunction via Restoration of Perivascular Adipose Tissue Homeostasis in Mice

Article information

Int Neurourol J. 2025;29(Suppl 1):S35-S43
Publication date (electronic) : 2025 July 31
doi : https://doi.org/10.5213/inj.2550142.071
1Department of Sport Science, Chungnam National University, Daejeon, Korea
2Department of Rehabilitation Medicine, Zhongguancun Hospital, Beijing, China
3Exercise and Metabolism Research Center, College of Physical Education and Health Sciences, Zhejiang Normal University, Jinhua, China
4College of Pharmacy, Chungnam National University, Daejeon, Korea
5Department of Biochemistry, Chungnam National University, Daejeon, Korea
Corresponding author: Sang Ki Lee Department of Sport Science, College of Natural Science, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon 34134, Korea Email: nicelsk@cnu.ac.kr
Co-corresponding author: Wei Li Exercise and Metabolism Research Center, College of Physical Education and Health Sciences, Zhejiang Normal University, Jinhua, China Email: ty1986@zjnu.edu.cn
Received 2025 April 30; Accepted 2025 July 1.

Abstract

Purpose

Perivascular adipose tissue (PVAT) dysfunction contributes to vascular impairment in obesity, primarily through altered lipid accumulation, inflammatory cytokine imbalance, and disrupted endothelial signaling. This study aimed to investigate whether aerobic exercise can ameliorate PVAT-induced vascular dysfunction in mice with obesity induced by a high-fat diet.

Methods

Male C57BL/6J mice were fed either a chow or a high-fat diet for 12 weeks, followed by 8 weeks of aerobic treadmill training or sedentary control. Body weight, PVAT morphology, and levels of inflammatory cytokines (tumor necrosis factor alpha, interleukin 1β, monocyte chemoattractant protein 1, and intercellular adhesion molecule 1), adipokines (leptin and adiponectin), and phosphorylation of endothelial signaling proteins (Akt, AMP-activated protein kinase [AMPK], and endothelial nitric oxide synthase [eNOS]) were evaluated in the thoracic aorta and PVAT. Endothelium-dependent relaxation (EDR) was assessed using acetylcholine-induced vasodilation in aortic rings with or without PVAT.

Results

High-fat diet-induced obesity led to increased adipocyte size in PVAT, while it also impaired vascular relaxation, elevated levels of proinflammatory cytokines, and reduced phosphorylation of Akt, AMPK, and eNOS in both PVAT and the aorta. Aerobic exercise training significantly reduced PVAT adipocyte size, restored EDR, suppressed inflammatory cytokine levels, increased adiponectin expression, and promoted phosphorylation of vascular signaling molecules in both PVAT and the aorta.

Conclusions

Aerobic exercise training restores PVAT homeostasis and endothelial function in obese mice by modulating inflammation, adipokines, and vascular signaling. These findings suggest aerobic exercise as a nonpharmacological approach to improve vascular function in obesity by targeting PVAT dysfunction.

• HIGHLIGHTS

- Aerobic exercise training reduces body weight and perivascular adipose tissue (PVAT) lipid accumulation in obese mice.

- Aerobic exercise enhances endothelium-dependent relaxation in the aorta, with and without PVAT.

- Aerobic exercise modulates inflammatory cytokines, adipokine balance and AMPK/Akt/eNOS axis in both of aorta and PVAT.

- Aerobic exercise attenuates vascular dysfunction by restoring PVAT homeostasis.

INTRODUCTION

Adipose tissue, primarily composed of adipocytes, is broadly categorized into white adipose tissue (WAT) and brown adipose tissue (BAT). WAT serves as the body’s main energy reservoir and provides mechanical protection for internal organs. However, excessive WAT accumulation is strongly associated with metabolic disorders, including obesity, type 2 diabetes, and cardiovascular disease [1]. In contrast, BAT plays key roles in thermogenesis and energy expenditure and is considered beneficial for metabolic health [2].

In addition to WAT and BAT, ectopic fat depots such as perivascular adipose tissue (PVAT) have emerged as important regulators of vascular function. PVAT surrounds most large arteries and exerts paracrine effects on the vasculature by releasing vasoactive factors. Under physiological conditions, PVAT exhibits anticontractile properties that help regulate vascular tone [3]. However, in obesity and metabolic syndrome, PVAT undergoes structural and functional changes, including adipocyte hypertrophy, inflammatory cytokine secretion, and impaired vasodilatory signaling, ultimately promoting vascular dysfunction [4-6].

Recent research has indicated that obesity-induced PVAT inflammation increases proinflammatory cytokine expression and promotes the infiltration of immune cells, including macrophages [7]. Moreover, PVAT inflammation has been linked to vascular diseases such as hypertension and atherosclerosis [8], in which it diminishes the anticontractile effects on small arteries [9, 10].

AMP-activated protein kinase (AMPK) is a central regulator of metabolic and vascular homeostasis and modulates endothelial nitric oxide synthase (eNOS) activity. AMPK expression and activity are known to be reduced in obesity and vascular dysfunction [11-13]. Although several studies have shown that exercise activates AMPK and eNOS in endothelial cells and skeletal muscle, little is known about the effects of exercise on AMPK/eNOS signaling within PVAT in obesity.

Regular aerobic exercise is a well-established strategy for improving vascular function and reducing inflammation in animal models and humans with obesity [13-15]. Several animal studies have demonstrated that exercise promotes endothelium-dependent relaxation (EDR) and reduces oxidative stress, partly by activating AMPK and eNOS [16]. However, the specific effects of aerobic exercise on PVAT-induced vascular dysfunction, particularly in the context of high-fat diet-induced obesity, remain poorly understood.

While several studies have demonstrated that exercise improves endothelial function through the activation of AMPK and eNOS, these findings have primarily focused on the vascular wall itself [14, 15], with limited attention given to PVAT. Very few studies have comprehensively addressed how exercise affects vascular function through the integrated roles of the vascular wall and the surrounding PVAT, representing a critical gap in our understanding of the vascular benefits of exercise in obesity.

Therefore, the purpose of this study was to investigate whether aerobic exercise training could ameliorate vascular dysfunction by restoring PVAT homeostasis in a mouse model of high-fat diet-induced obesity.

MATERIALS AND METHODS

Animals

Male C57BL/6J mice (8 weeks old, n=32; Charles River Laboratories, China) were housed 4 per cage under standard laboratory conditions (22°C±2°C, 55%±10% humidity, reversed 12-hour reversed light/dark cycle). The mice were provided a chow diet (D12450B; Research Diets, USA) and water ad libitum for a 2-week acclimation period. After acclimation, the mice were randomly assigned to either the chow diet group (C, n=16) or the high-fat diet group (HF, D12492; n =16). Following 12 weeks of dietary intervention, each group was further divided to either maintain sedentary behavior or undergo an exercise regimen, with the latter yielding chow diet with exercise (C+E, n = 8) and HF with exercise (HF+E, n = 8) subgroups. Food and water were available ad libitum throughout the experiment.

Aerobic Exercise Training

Aerobic exercise training was performed on a motorized treadmill for 8 weeks. On the first day, mice ran at 10 m/min with a 0% incline for 10 minutes. Both speed and duration were progressively increased each week, reaching 22 m/min for 60 minutes by the sixth week and maintained at this level until the end of the training period. This intensity corresponded to approximately 65%–70% of maximal oxygen uptake [17].

Body Weight and Energy Intake

Body weight was measured weekly until sacrifice. To assess food intake, 200 g of chow or high-fat diet was provided per cage (with each cage housing 4 mice), and the remaining food was weighed twice weekly using an automatic electronic balance. Total energy intake was calculated by multiplying food intake by 3.1 kcal/g for the chow diet and 5.24 kcal/g for the high-fat diet.

Hematoxylin-Eosin Staining

Samples of the aorta and PVAT were fixed in 4% paraformaldehyde for 24 hours. Tissues were then dehydrated, cleared, and infiltrated sequentially with alcohol, xylene, and paraffin wax. Paraffin-embedded tissues were sectioned at a thickness of 5 μm and stained with hematoxylin and eosin (MHS-32; Sigma-Aldrich, USA). Histological structures of the aorta and PVAT were examined using a light microscope (Eclipse CI; Nikon, Japan).

Endothelium-Dependent Relaxation

Thoracic aortas were isolated and cut into 2–3 mm rings, with PVAT either preserved or removed. The aortic rings were mounted on force transducers in Krebs-Henseleit buffer (NaCl 100mM, KCl 4.7mM, CaCl2 1.9mM, MgSO4 1.2mM, K2HPO4 1.03mM, NaHCO3 25mM, glucose 11.1mM; pH 7.4), continuously aerated with 95% O2 and 5% CO2. Isometric tension was recorded using the Biopac MP150 system. After a 1-hour equilibration period, the rings were pre-contracted with phenylephrine (0.3 μM; Sigma, UK), followed by cumulative addition of acetylcholine (1 nM–10 μM; Sinopharm, China) to assess EDR.

Quantitative Real-Time Polymerase Chain Reaction

Total RNA was extracted from frozen aorta and PVAT tissues using TRIzol reagent (Life Technologies, USA), followed by chloroform extraction and ethanol precipitation. RNA concentration and purity were determined using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). Complementary DNA (cDNA) was synthesized using oligo(dT)15 primers (Takara Bio Inc., Japan) and reverse transcriptase (NEB, China) according to the manufacturer’s instructions. Quantitative real-time polymerase chain reaction (PCR) was performed using SYBR Green Master Mix on an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific). Each reaction (25 μL) contained cDNA, gene-specific primers (TsingKe, China), ROX dye, and RNase-free water. The PCR cycling conditions included initial denaturation at 95°C for 15 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds, with a final melting curve analysis. Primer sequences and melting temperatures are listed in Table 1.

Primer sequences used for real-time polymerase chain reaction

Western Blotting

Protein was extracted from the aorta and PVAT using lysis buffer, and concentrations were determined by bicinchoninic acid assay. Equal amounts of protein (20 μg for PVAT, 35 μg for the aorta) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to polyvinylidene difluoride membranes, and incubated with primary antibodies against Akt, phospho-Akt (p-Akt), AMPK, phospho-AMPK, eNOS, phospho-eNOS (p-eNOS) (Cell Signaling Technology, USA), and β-actin. After incubation with horseradish peroxidase-conjugated secondary antibodies, bands were visualized using chemiluminescence (Thermo Fisher Scientific) and quantified with ImageQuant software.

Statistical Analysis

Statistical analyses were performed using IBM SPSS Statistics 29.0 (IBM Co., USA). Repeated measures analysis of variance (ANOVA) and 1-way ANOVA were used to analyze differences among groups. The Duncan post hoc test was applied for multiple comparisons. P-values of less than 0.05 were considered to indicate statistical significance.

RESULTS

Aerobic Exercise Training Inhibits Body Weight Gain Without Altering Energy Intake

Body weight changes are presented in Fig. 1A. Following 12 weeks of a high-fat diet, 8 weeks of aerobic exercise training significantly inhibited body weight gain compared to both the C group (30.84 ± 0.20 g vs. 28.68 ± 0.06 g) and the HF group (30.84 ± 0.20 g vs. 37.04 ±0.16 g), without significantly altering energy intake (Fig. 1B).

Fig. 1.

Aerobic exercise training inhibited body weight gain without altering energy intake in high-fat diet-induced mice. (A) Body weight. (B) Energy intake. C, chow diet control; C+E, chow diet with exercise; HF, high-fat diet; HF+E, high-fat diet with exercise. Data are presented as mean±standard error of the mean. *P<0.05, C vs. C+E; P<0.05, C vs. HF; #P<0.05, HF vs. HF+E.

Aerobic Exercise Training Reduces Lipid Droplet Content in PVAT

The effects of aerobic exercise training on lipid droplet content in PVAT were examined (Fig. 2). Compared to the C group (187.10 ± 5.38 μm2), the HF group (206.98 ± 1.04 μm2) exhibited a significant increase in lipid droplet content (Fig. 2B and C). In high-fat diet-fed mice, aerobic exercise training (HF+E, 198.40 ±1.45 μm2) significantly reduced PVAT adipocyte size compared to the HF group (Fig. 2B and C).

Fig. 2.

Aerobic exercise training reduced lipid droplet content in the perivascular adipose tissue (PVAT) of high-fat diet-induced mice. (A) Thoracic aorta and PVAT. (B) Lipid droplets in PVAT. (C) Quantification of lipid droplets in PVAT by planimetry. C, chow diet control; C+E, chow diet with exercise; HF, high-fat diet; HF+E, high-fat diet with exercise. Data are presented as mean±standard error of the mean. P<0.05, C vs. HF; #P<0.05, HF vs. HF+E. Hematoxylin and eosin images: ×100 (A), ×400 (B); scale bars: 100 μm (A), 50 μm (B).

Aerobic Exercise Improves EDR in the Aorta With and Without PVAT

The effects of aerobic exercise training on EDR in the thoracic aorta were investigated (Fig. 3). The HF group exhibited significantly reduced EDR in response to 10 –5 M acetylcholine compared to the C group, both with PVAT (40.10±0.58 vs. 98.94±0.40) and without PVAT (47.92±0.44 vs. 96.37±0.13) (Fig. 3A and B). However, aerobic exercise training significantly improved EDR in the aorta compared to the HF group, both with (59.31 ±0.71 vs. 40.10 ±0.58) and without PVAT (65.27 ±1.32 vs. 47.92 ± 0.44) (Fig. 3A and B).

Fig. 3.

Aerobic exercise training improved endothelial-dependent relaxation (EDR) in the aorta with and without perivascular adipose tissue (PVAT) in high-fat diet-induced mice. (A) EDR with PVAT. (B) EDR without (w/o) PVAT. C, chow diet control; C+E, chow diet with exercise; HF, high-fat diet; HF+E, high-fat diet with exercise. Data are presented as mean±standard error of the mean. P<0.05, C vs. HF; #P<0.05, HF vs. HF+E.

Aerobic Exercise Suppresses High-Fat Diet-Induced Proinflammatory Cytokine Expression and Promotes Anti-Inflammatory Cytokine Expression in the Aorta and PVAT

mRNA expression levels for inflammatory cytokines (tumor necrosis factor alpha [TNF-α], interleukin 1β, monocyte chemoattractant protein 1 [MCP-1], intercellular adhesion molecule 1 [ICAM-1], and leptin) and an anti-inflammatory adipokine (adiponectin) were analyzed in the aorta and PVAT (Fig. 4). Compared to the C group, the HF group displayed significant increases in proinflammatory cytokine (TNF-α, 35.91 ± 1.92 vs. 0.98 ±0.01) and adipokine (leptin, 9.39 ±0.06 vs. 1.07 ±0.06) expression (Fig. 4A–E) but a decrease in anti-inflammatory adipokine (adiponectin, 0.05±0.01 vs. 0.86±0.04) expression (Fig. 4F). In contrast, aerobic exercise training significantly reduced proinflammatory cytokine expression (TNF-α, 12.98 ±2.20 vs. 35.91 ±1.92) and increased anti-inflammatory adipokine mRNA levels (adipokine, 0.05±0.01 vs. 0.28±0.05) in both the aorta (Fig. 4A–F) and PVAT (Fig. 4G–L), compared to the HF group.

Fig. 4.

Aerobic exercise improved levels of proinflammatory and anti-inflammatory cytokines in the aorta and perivascular adipose tissue (PVAT) of high-fat diet-induced mice. The images depict relative mRNA levels of tumor necrosis factor alpha (TNF-α), interleukin (IL)-1β, monocyte chemoattractant protein 1 (MCP-1), intercellular adhesion molecule 1 (ICAM-1), leptin, and adiponectin in the aorta (A–F) and PVAT (G–L). C, chow diet control; C+E, chow diet with exercise; HF, high-fat diet; HF+E, high-fat diet with exercise. Data are presented as mean±standard error of the mean. *P<0.05, C vs. C+E; P<0.05, C vs. HF; #P<0.05, HF vs. HF+E.

Aerobic Exercise Improves Phosphorylation of AMPK/Akt/eNOS in the Aorta and PVAT

Phosphorylation levels of AMPK, Akt, and eNOS were measured in the aorta and PVAT (Fig. 5). The HF group exhibited significantly reduced phosphorylation of AMPK (0.38±0.01 vs. 1.00±0.00), Akt (0.59±0.03 vs. 1.00±0.00), and eNOS (0.34±0.01 vs. 1.00±0.00) in the aorta (Fig. 5A) and PVAT (AMPK, 0.22±0.01 vs. 1.00±0.00; Akt, 0.49±0.02 vs. 1.00±0.00; eNOS, 0.52 ±0.02 vs. 1.00 ±0.00) (Fig. 5B) compared to the C group. However, aerobic exercise training significantly restored the phosphorylation of these signaling molecules in both the aorta (AMPK, 0.61 ±0.04 vs. 0.38 ±0.01; Akt, 0.81 ±0.08 vs. 0.59 ± 0.03; eNOS, 0.74 ±0.01 vs. 0.34 ±0.01) (Fig. 5A) and PVAT (AMPK, 0.76 ±0.07 vs. 0.22 ±0.01; Akt, 0.87 ±0.04 vs. 0.49 ± 0.02; eNOS, 0.72 ±0.00 vs. 0.52 ±0.02) (Fig. 5B) compared to the HF group.

Fig. 5.

Aerobic exercise promoted phosphorylation of AMP-activated protein kinase (AMPK)/Akt/endothelial nitric oxide synthase (eNOS) in the aorta and perivascular adipose tissue (PVAT) of high-fat diet-induced mice. The images depict western blotting and quantification of the expression and phosphorylation of AMPK, AKT, and eNOS in the aorta (A) and PVAT (B). p-AMPK, phospho-AMPK; p-AKT, phospho-AKT; p-eNOS, phospho-eNOS; C, chow diet control; C+E, chow diet with exercise; HF, high-fat diet; HF+E, high-fat diet with exercise. Data are presented as mean±standard error of the mean. *P<0.05, C vs. C+E; P<0.05, C vs. HF; #P<0.05, HF vs. HF+E.

DISCUSSION

This study demonstrates that aerobic exercise training exerts beneficial effects on vascular function and inflammation in both the thoracic aorta and PVAT in mice with obesity induced by a high-fat diet. The C57BL/6J mice, known for their susceptibility to diet-induced obesity [16], exhibited approximately 30% weight gain after 12 weeks of high-fat diet feeding, confirming successful establishment of the obesity model. Aerobic exercise reduced body weight and fat mass, likely through increased energy expenditure, improved lipid oxidation, and regulation of obesity-related gene expression (Fig. 1). While body weight is widely used as a key obesity indicator, the exercise-induced effects observed in this study may reflect improved metabolic function rather than changes in size alone [18, 19].

Regarding vascular function, the present findings indicate that PVAT dysfunction exacerbates impairment in EDR, particularly in the context of obesity. Acetylcholine-induced vasodilation was more severely impaired in aortic segments with intact PVAT, highlighting the pathological role of PVAT dysfunction (Fig. 3). Aerobic exercise significantly improved this vasodilatory response, accompanied by increased phosphorylation of eNOS and its upstream regulator Akt in both the aorta and PVAT (Figs. 3A, B, and 5). These results suggest that the beneficial vascular effects of exercise are mediated through the Akt/eNOS signaling pathway.

Previous studies have demonstrated that a chronic high-fat diet suppresses eNOS expression and activity [20, 21], while exercise restores these parameters in PVAT [22-24]. Consistent with this mechanism, treadmill training in the current study increased both p-eNOS and p-Akt levels in vascular tissues, supporting the role of this pathway in improving PVAT-mediated vascular function.

In addition to enhancing signaling activity, exercise training effectively reduced inflammation in PVAT [25]. As an active endocrine organ, PVAT secretes numerous cytokines that modulate vascular tone [9]. In this study, aerobic exercise suppressed the expression of proinflammatory markers, including TNF-α, ILβ, MCP-1, ICAM-1, and leptin, while promoting the expression of the anti-inflammatory adipokine adiponectin in both the aorta and PVAT (Fig. 4). Histological analysis revealed smaller adipocytes and reduced lipid droplet content in the PVAT of mice subjected to exercise (Fig. 2B and C). Moreover, the morphological characteristics of PVAT, including circular nuclei and multilocular lipid droplets, resembled BAT; this finding aligns with reports that aortic PVAT comprises mixed white and brown adipocytes [26, 27].

Leptin, which is often elevated in obesity, contributes to atherosclerosis by promoting monocyte chemotaxis, foam cell formation, and vascular smooth muscle cell proliferation [28]. The observed increase in leptin mRNA in the PVAT of obese mice — as well as its reduction following the exercise regimen — suggests a local, PVAT-specific effect on vascular dysfunction (Fig. 4E and K). Previous studies have also indicated that PVAT-derived leptin may act independently of systemic leptin levels [29, 30] and that inhibition of leptin signaling in PVAT improves endothelial function in the context of obesity [31].

Conversely, adiponectin is known to exert anti-inflammatory and antioxidative effects and plays a protective role in vascular physiology [32]. In this study, exercise increased adiponectin expression, likely contributing to enhanced phosphorylation of AMPK in PVAT. AMPK activation improves vascular homeostasis by regulating lipid metabolism, inflammation, and cellular signaling [33]. Moreover, AMPK phosphorylation in PVAT may reflect enhanced metabolic capacity, aligning with previous reports of AMPK upregulation following exercise, although these findings were initially observed in skeletal muscle [34].

In this study, aerobic exercise significantly increased AMPK phosphorylation in both the thoracic aorta and PVAT (Fig. 5), indicating tissue-wide metabolic activation. Notably, the magnitude of AMPK phosphorylation was greater in PVAT, suggesting higher metabolic responsiveness in adipose tissue compared to vascular tissue. In the aorta, AMPK activation may have contributed primarily to endothelial homeostasis by promoting eNOS phosphorylation and nitric oxide bioavailability, as previously reported [35]. In contrast, in PVAT, AMPK signaling appears to regulate not only vascular tone through paracrine factors but also adipocyte metabolism and inflammation [33, 36]. This differential role highlights the tissue-specific actions of AMPK in mediating both structural and functional recovery of the vascular environment in obesity.

Collectively, these findings indicate that aerobic exercise training ameliorates PVAT-induced vascular dysfunction in obese mice by reducing lipid accumulation in PVAT, alleviating PVAT inflammation, restoring adipokine balance, and activating the AMPK–Akt–eNOS axis. These mechanisms highlight the therapeutic potential of exercise as an effective nonpharmacological strategy to protect against obesity-related vascular complications through PVAT modulation.

Notes

Grant/Fund Support

This work was supported by the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (RS-2022-NR070856), and BK21 FOUR Program by Chungnam National University Research Grant, 2023.

Research Ethics

All experimental procedures were approved by the Animal Care and Use Committee of Beijing Sport University (2015ZD006) and conducted in accordance with institutional guidelines.

Conflict of Interest

No potential conflict of interest relevant to this article was reported.

AUTHOR CONTRIBUTION STATEMENT

· Conceptualization: ML, WL, SKL

· Data curation: ML, WL

· Formal analysis: ML, WL, YZ

· Funding acquisition: SKL, GSJ, KKK, HMK

· Methodology: ML, WJ, SJ, SL, MK

· Project administration: ML, WJ

· Visualization: WJ, YZ, SJ, SL, MK

· Writing - original draft: ML, SKL

· Writing - review & editing WL, SKL, GSJ, KKK, HMK

References

1. Jin X, Qiu T, Li L, Yu R, Chen X, Li C, et al. Pathophysiology of obesity and its associated diseases. Acta Pharm Sin B 2023;13:2403–24.
2. Fantuzzi G. Adipose tissue, adipokines, and inflammation. J Allergy Clin Immunol 2005;115:911–9.
3. Soltis EE, Cassis LA. Influence of perivascular adipose tissue on rat aortic smooth muscle responsiveness. Clin Exp Hypertens A 1991;13:277–96.
4. Lee HY, Després JP, Koh KK. Perivascular adipose tissue in the pathogenesis of cardiovascular disease. Atherosclerosis 2013;230:177–84.
5. Chatterjee TK, Stoll LL, Denning GM, Harrelson A, Blomkalns AL, Idelman G, et al. Proinflammatory phenotype of perivascular adipocytes: influence of high-fat feeding. Circ Res 2009;104:541–9.
6. Lastra G, Manrique C. Perivascular adipose tissue, inflammation and insulin resistance: link to vascular dysfunction and cardiovascular disease. Horm Mol Bio Clin Investig 2015;22:19–26.
7. Chen Y, Qin Z, Wang Y, Li X, Zheng Y, Liu Y. Role of inflammation in vascular disease-related perivascular adipose tissue dysfunction. Front Endocrinol 2021;12:710842.
8. Hu H, Garcia-Barrio M, Jiang ZS, Chen YE, Chang L. Roles of perivascular adipose tissue in hypertension and atherosclerosis. Antioxid Redox Signal 2021;34:736–49.
9. Xia N, Li H. The role of perivascular adipose tissue in obesity‐induced vascular dysfunction. Br J Pharmacol 2017;174:3425–42.
10. Ramirez J, O’Malley E, Ho W. Pro‐contractile effects of perivascular fat in health and disease. Br J Pharmacol 2017;174:3482–95.
11. Rodríguez C, Muñoz M, Contreras C, Prieto D. AMPK, metabolism, and vascular function. FEBS J 2021;288:3746–71.
12. Deng G, Long Y, Yu Y, Li M. Adiponectin directly improves endothelial dysfunction in obese rats through the AMPK–eNOS Pathway. Int J Obe (Lond) 2010;34:165–71.
13. Engin A. Endothelial dysfunction in obesity and therapeutic targets. Adv Exp Med Biol 2024;1460:489–538.
14. Cacicedo JM, Gauthier MS, Lebrasseur NK, Jasuja R, Ruderman NB, Ido Y. Acute exercise activates AMPK and eNOS in the mouse aorta. Am J Physiol Heart Circ Physiol 2011;301:H1255–65.
15. Chen X, An X, Chen D, Ye M, Shen W, Han W, et al. Chronic exercise training improved aortic endothelial and mitochondrial function via an AMPKα2-dependent manner. Front Physiol 2016;7:631.
16. Parekh PI, Petro AE, Tiller JM, Feinglos MN, Surwit RS. Reversal of diet-induced obesity and diabetes in C57BL/6J mice. Metabolism 1998;47:1089–96.
17. Schefer V, Talan MI. Oxygen consumption in adult and AGED C57BL/6J mice during acute treadmill exercise of different intensity. Exp Gerontol 1996;31:387–92.
18. Straznicky NE, Grima MT, Lambert EA, Eikelis N, Dawood T, Lambert GW, et al. Exercise augments weight loss induced improvement in renal function in obese metabolic syndrome individuals. J Hypertens 2011;29:553–64.
19. Carroll S, Dudfield M. What is the relationship between exercise and metabolic abnormalities? A review of the metabolic syndrome. Sports Med 2004;34:371–418.
20. Boa BC, Souza Md, Leite RD, da Silva SV, Barja-Fidalgo TC, Kraemer-Aguiar LG, et al. Chronic aerobic exercise associated to dietary modification improve endothelial function and eNOS expression in high fat fed hamsters. PLoS One 2014;9e102554.
21. Silva JF, Correa IC, Diniz TF, Lima PM, Santos RL, Cortes SF, et al. Obesity, inflammation, and exercise training: relative contribution of iNOS and eNOS in the modulation of vascular function in the mouse aorta. Front Physiol 2016;7:386.
22. Araujo HN, da Silva CPV, Sponton AC, Clerici SP, Davel AP, Antunes E, et al. Perivascular adipose tissue and vascular responses in healthy trained rats. Life Sci 2015;125:79–87.
23. Meziat C, Boulghobra D, Strock E, Battault S, Bornard I, Walther G, et al. Exercise training restores eNOS activation in the perivascular adipose tissue of obese rats: Impact on vascular function. Nitric Oxide 2019;86:63–7.
24. Sousa AS, Sponton AC, Trifone CB, Delbin MA. Aerobic exercise training prevents perivascular adipose tissue-induced endothelial dysfunction in thoracic aorta of obese mice. Front Physiol 2019;10:1009.
25. Boa B, Yudkin J, Van Hinsbergh V, Bouskela E, Eringa E. Exercise effects on perivascular adipose tissue: endocrine and paracrine determinants of vascular function. Br J Pharmacol 2017;174:3466–81.
26. Angueira AR, Sakers AP, Holman CD, Cheng L, Arbocco MN, Shamsi F, et al. Defining the lineage of thermogenic perivascular adipose tissue. Nat Metab 2021;3:469–84.
27. Schirinzi V, Poli C, Berteotti C, Leone A. Browning of adipocytes: a potential therapeutic approach to obesity. Nutrients 2023;15:2229.
28. Qi XY, Qu SL, Xiong WH, Rom O, Chang L, Jiang ZS. Perivascular adipose tissue (PVAT) in atherosclerosis: a double-edged sword. Cardiovasc Diabetol 2018;17:134.
29. Shibasaki I, Nishikimi T, Mochizuki Y, Yamada Y, Yoshitatsu M, Inoue Y, et al. Greater expression of inflammatory cytokines, adrenomedullin, and natriuretic peptide receptor-C in epicardial adipose tissue in coronary artery disease. Regul Pept 2010;165:210–7.
30. Jaffer I, Riederer M, Shah P, Peters P, Quehenberger F, Wood A, et al. Expression of fat mobilizing genes in human epicardial adipose tissue. Atherosclerosis 2012;220:122–7.
31. Payne GA, Borbouse L, Kumar S, Neeb Z, Alloosh M, Sturek M, et al. Epicardial perivascular adipose-derived leptin exacerbates coronary endothelial dysfunction in metabolic syndrome via a protein kinase C-β pathway. Arterioscler Thromb Vasc Biol 2010;30:1711–7.
32. Antoniades C, Antonopoulos A, Tousoulis D, Stefanadis C. Adiponectin: from obesity to cardiovascular disease. Obes Rev 2009;10:269–79.
33. Almabrouk TA, White AD, Ugusman AB, Skiba DS, Katwan OJ, Alganga H, et al. High fat diet attenuates the anticontractile activity of aortic PVAT via a mechanism involving AMPK and reduced adiponectin secretion. Front Physiol 2018;9:51.
34. Reznick RM, Shulman GI. The role of AMP‐activated protein kinase in mitochondrial biogenesis. J Physiol 2006;574:33–9.
35. Sanz-Gómez M, Aledavood E, Beroiz-Salaverri M, Lagartera L, Vega-Martín E, Gil-Ortega M, et al. Novel indolic AMPK modulators induce vasodilatation through activation of the AMPK–eNOS–NO pathway. Sci Rep 2022;12:4225.
36. Almabrouk T, Ewart M, Salt I, Kennedy S. Perivascular fat, AMP‐activated protein kinase and vascular diseases. Br J Pharmacol 2014;171:595–617.

Article information Continued

Fig. 1.

Aerobic exercise training inhibited body weight gain without altering energy intake in high-fat diet-induced mice. (A) Body weight. (B) Energy intake. C, chow diet control; C+E, chow diet with exercise; HF, high-fat diet; HF+E, high-fat diet with exercise. Data are presented as mean±standard error of the mean. *P<0.05, C vs. C+E; P<0.05, C vs. HF; #P<0.05, HF vs. HF+E.

Fig. 2.

Aerobic exercise training reduced lipid droplet content in the perivascular adipose tissue (PVAT) of high-fat diet-induced mice. (A) Thoracic aorta and PVAT. (B) Lipid droplets in PVAT. (C) Quantification of lipid droplets in PVAT by planimetry. C, chow diet control; C+E, chow diet with exercise; HF, high-fat diet; HF+E, high-fat diet with exercise. Data are presented as mean±standard error of the mean. P<0.05, C vs. HF; #P<0.05, HF vs. HF+E. Hematoxylin and eosin images: ×100 (A), ×400 (B); scale bars: 100 μm (A), 50 μm (B).

Fig. 3.

Aerobic exercise training improved endothelial-dependent relaxation (EDR) in the aorta with and without perivascular adipose tissue (PVAT) in high-fat diet-induced mice. (A) EDR with PVAT. (B) EDR without (w/o) PVAT. C, chow diet control; C+E, chow diet with exercise; HF, high-fat diet; HF+E, high-fat diet with exercise. Data are presented as mean±standard error of the mean. P<0.05, C vs. HF; #P<0.05, HF vs. HF+E.

Fig. 4.

Aerobic exercise improved levels of proinflammatory and anti-inflammatory cytokines in the aorta and perivascular adipose tissue (PVAT) of high-fat diet-induced mice. The images depict relative mRNA levels of tumor necrosis factor alpha (TNF-α), interleukin (IL)-1β, monocyte chemoattractant protein 1 (MCP-1), intercellular adhesion molecule 1 (ICAM-1), leptin, and adiponectin in the aorta (A–F) and PVAT (G–L). C, chow diet control; C+E, chow diet with exercise; HF, high-fat diet; HF+E, high-fat diet with exercise. Data are presented as mean±standard error of the mean. *P<0.05, C vs. C+E; P<0.05, C vs. HF; #P<0.05, HF vs. HF+E.

Fig. 5.

Aerobic exercise promoted phosphorylation of AMP-activated protein kinase (AMPK)/Akt/endothelial nitric oxide synthase (eNOS) in the aorta and perivascular adipose tissue (PVAT) of high-fat diet-induced mice. The images depict western blotting and quantification of the expression and phosphorylation of AMPK, AKT, and eNOS in the aorta (A) and PVAT (B). p-AMPK, phospho-AMPK; p-AKT, phospho-AKT; p-eNOS, phospho-eNOS; C, chow diet control; C+E, chow diet with exercise; HF, high-fat diet; HF+E, high-fat diet with exercise. Data are presented as mean±standard error of the mean. *P<0.05, C vs. C+E; P<0.05, C vs. HF; #P<0.05, HF vs. HF+E.

Table 1.

Primer sequences used for real-time polymerase chain reaction

Primer Order Sequence (5'→3') Temperature (°C)
GAPDH Forward GAGAGGCCCTATCCCAACTC 59.5
Reverse TATGGGGGTCTGGGATGGAAA 57.6
IL-1β Forward ACCTCACAAGCAGAGCACAA 55.4
Reverse GGAGCTCCTTAACATGCCCT 57.4
ICAM-1 Forward ACACCTTTGTTAGCCACCTCC 57.6
Reverse GACCGCTGAGTGTCATTGTG 57.4
TNF-α Forward TGGGGGACCCAATGTAGGAG 59.5
Reverse AGCCTATTGTTCAGCTCCGT 55.4
Leptin Forward ACAGTTTCGTGCTCAGCTCTGTCT 55.4
Reverse ACCCTCAGCTCAGGTTCTTTCACA 55.4
MCP-1 Forward AAGGTCCCTGTCATGCTTCTG 57.4
Reverse TCTGGACCCATTCCTTCTTG 55.4
Adiponectin Forward AGATGGCACTCCTGGAGAGAAG 55.4
Reverse ACATAAGCGGCTTCTCCAGGCT 57.4

IL-1β, interleukin 1β; ICAM-1, intercellular adhesion molecule 1; TNF-α, tumor necrosis factor alpha; MCP-1, monocyte chemoattractant protein 1.